Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_104075 | |||
Gene | NUP153 | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
DBLink | Link to database | PMID | 28710406 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 4 pair of snap-frozen Hepatocelluar Carcinoma (HCC) tissue and matched para-carcinoma tissue |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GAAGATGTCAAGCCCTTTAGC ReverseGAGTTGCTTAGCTTTCATTTGTC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Huang, XY, Huang, ZL, Xu, YH, Zheng, Q, Chen, Z, Song, W, Zhou, J, Tang, ZY, Huang, XY (2017). Comprehensive circular RNA profiling reveals the regulatory role of the circRNA-100338/miR-141-3p pathway in hepatitis B-related hepatocellular carcinoma. Sci Rep, 7, 1:5428. |